View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_14 (Length: 310)
Name: NF0744_low_14
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 66 - 305
Target Start/End: Original strand, 2615345 - 2615575
Alignment:
| Q |
66 |
tcatactctattttgttgcttttccttttcatcacagtactacgttggtatgaatactttttggttgtggtggcaaatgtgtggtggtgatggtgagaaa |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
2615345 |
tcatactctatttggttgcttttccttttcatcacagtactacgttggtatgaatactttttggttgtggtggcaaatgtgtggtg---------aaaaa |
2615435 |
T |
 |
| Q |
166 |
aatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttttcatggtttttggtttga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2615436 |
aatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttttcatggtttttggtttga |
2615535 |
T |
 |
| Q |
266 |
ttggtgccattggtgatggattaatgacccctttgcttct |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2615536 |
ttggtgccattggtgatggactaatgacccctttgcttct |
2615575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 129 - 300
Target Start/End: Complemental strand, 2679982 - 2679814
Alignment:
| Q |
129 |
gttgtggtggcaaatgtgtggtggtgatggtgagaaaaatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgct |
228 |
Q |
| |
|
|||||| | ||||||| ||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
2679982 |
gttgtgattgcaaatgggtggtggtgatc---agaaaaatgtttccattaatgttaagaaaaagaaaaatggttcttttaggtccattttcatgcatgct |
2679886 |
T |
 |
| Q |
229 |
gatgttcttgattggtttttcatggtttttggtttgattggtgccattggtgatggattaatgacccctttg |
300 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
2679885 |
gatgttcttgattgttttttcatggcttttggtttgattggtgccattggtgatggactaatgactcctttg |
2679814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 148 - 284
Target Start/End: Original strand, 2429285 - 2429421
Alignment:
| Q |
148 |
ggtggtgatggtgagaaaaatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttt |
247 |
Q |
| |
|
||||||| || | |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429285 |
ggtggtggtgatcagaaaaatgtttccattaatgataagaaaaagaaaaatggttctttcaagtccattttcatgcatgctgatgttcttgattggtttt |
2429384 |
T |
 |
| Q |
248 |
tcatggtttttggtttgattggtgccattggtgatgg |
284 |
Q |
| |
|
|||||| ||||||||| |||| || ||||||||||| |
|
|
| T |
2429385 |
tcatggcttttggtttttttggggctattggtgatgg |
2429421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 148 - 284
Target Start/End: Complemental strand, 2603242 - 2603106
Alignment:
| Q |
148 |
ggtggtgatggtgagaaaaatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttt |
247 |
Q |
| |
|
||||||| || | ||||||||||||||||||||| |||||||||||| ||||||||||| ||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
2603242 |
ggtggtggtgatcagaaaaatgtttccattaatgttaagaaaaagaaaaatggttcttttaagtcaattttcatgcatgcagatgttctagattggtttt |
2603143 |
T |
 |
| Q |
248 |
tcatggtttttggtttgattggtgccattggtgatgg |
284 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2603142 |
tcatggtttttggtttgattggttccattggtgatgg |
2603106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 161 - 303
Target Start/End: Complemental strand, 2647510 - 2647365
Alignment:
| Q |
161 |
agaaaaatgtttccattaatgataagaa---aaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttttcatggtttt |
257 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || || |||| ||| |
|
|
| T |
2647510 |
agaaaaatgtttccattaatgttaagaagaaaaagaaaaatggttcttttaagtccattttcatgcatgctgatgttcttgattgtttcttaatggcttt |
2647411 |
T |
 |
| Q |
258 |
tggtttgattggtgccattggtgatggattaatgacccctttgctt |
303 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
2647410 |
tggtttgtttggagccattggtgatggaataatgactcctttgctt |
2647365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 148 - 284
Target Start/End: Complemental strand, 2575226 - 2575090
Alignment:
| Q |
148 |
ggtggtgatggtgagaaaaatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttt |
247 |
Q |
| |
|
||||||| || | |||||||||||| |||| | | ||||||||||| ||||||||||| ||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
2575226 |
ggtggtggtgatcagaaaaatgtttacattgttaagaagaaaaagaaaaatggttcttttaagtcaattttcatgcatgcagatgttctagattggtttt |
2575127 |
T |
 |
| Q |
248 |
tcatggtttttggtttgattggtgccattggtgatgg |
284 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2575126 |
tcatggtttttggtttgattggttccattggtgatgg |
2575090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 161 - 297
Target Start/End: Original strand, 2445716 - 2445852
Alignment:
| Q |
161 |
agaaaaatgtttccattaatgataagaaaaagaagaatggttctttgaagtccattttcatgcatgctgatgttcttgattggtttttcatggtttttgg |
260 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
2445716 |
agaaaaatgtttctattaatgttaagaaaaagaaaaatggttcttttaagtccattttcatgcatgctgatgttctagactggtttttaatggtttttgg |
2445815 |
T |
 |
| Q |
261 |
tttgattggtgccattggtgatggattaatgacccct |
297 |
Q |
| |
|
|| |||| || ||||||||||| |||||| |||| |
|
|
| T |
2445816 |
ttcatttggggctattggtgatggcataatgatccct |
2445852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 2615279 - 2615326
Alignment:
| Q |
1 |
catcttatatataggtgtcagagaaaccttaaatcttactcacccttg |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2615279 |
catcttatatatagctgtcagagaaaccttaaatcttactcacacttg |
2615326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University