View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_17 (Length: 285)
Name: NF0744_low_17
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_low_17 |
 | |
|
| [»] scaffold0154 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0154 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 28 - 170
Target Start/End: Complemental strand, 22610 - 22468
Alignment:
| Q |
28 |
gagtgagatgaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaagatttaaattaagaggggaaaccgcgtttggt |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22610 |
gagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaagatttaaattaagaggggaaaccgcgtttggt |
22511 |
T |
|
| Q |
128 |
atgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22510 |
atgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
22468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4047 times since January 2019
Visitors: 4825