View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_18 (Length: 280)
Name: NF0744_low_18
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 62 - 237
Target Start/End: Complemental strand, 783607 - 783433
Alignment:
| Q |
62 |
aacaaaacaaaacagtcataaaagtaaatacatgtaaattgttttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783607 |
aacaaaacaaaacagtcataaaagtaaatacatgtaaattgttt-agcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaa |
783509 |
T |
 |
| Q |
162 |
ttaagcaagcattatgaatccttacacatcaaaaggttgcttaccagtaaatttaacctcaattgggctaacattc |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783508 |
ttaagcaagcattatcaatccttacacatcaaaaggttgcttaccagtaaatttaacctcaattgggctaacattc |
783433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University