View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_19 (Length: 269)
Name: NF0744_low_19
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 36529801 - 36529567
Alignment:
Q |
29 |
acttttgtgcactgcttcttatctccgttgttgcaattgagctttctaaaaatgagaaacaatgtatgtgtgtgactataattatatctatgtcaagtat |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
36529801 |
acttttgtgcactgcttcttatctccgttgttgcaattgagctttctaaaaatgagaaacaatgtatgtgtgt--ctataactatatctatgtcaagtat |
36529704 |
T |
 |
Q |
129 |
gcacaatttctttcttcttttaaattttacaaaaacaaattgtttattaatttgcagctggtgaaacaaaagaatcgaagacaaacatcggggtagatgg |
228 |
Q |
|
|
||||||||||||||||||||||||||| |||||| || ||||||||||| ||||||| || ||| |||||||||| ||||||||||||| ||||||||| |
|
|
T |
36529703 |
gcacaatttctttcttcttttaaatttcacaaaattaa-ttgtttattaaattgcagccggcgaagcaaaagaatcaaagacaaacatcgaggtagatgg |
36529605 |
T |
 |
Q |
229 |
caaagtacgttggtcaggtggaagagcaacatggcgaa |
266 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
T |
36529604 |
caaagtacgttggtcaggcggaagagcaacatggcgaa |
36529567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University