View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0744_low_19 (Length: 269)

Name: NF0744_low_19
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0744_low_19
NF0744_low_19
[»] chr5 (1 HSPs)
chr5 (29-266)||(36529567-36529801)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 36529801 - 36529567
Alignment:
29 acttttgtgcactgcttcttatctccgttgttgcaattgagctttctaaaaatgagaaacaatgtatgtgtgtgactataattatatctatgtcaagtat 128  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| ||||||||||||||||||    
36529801 acttttgtgcactgcttcttatctccgttgttgcaattgagctttctaaaaatgagaaacaatgtatgtgtgt--ctataactatatctatgtcaagtat 36529704  T
129 gcacaatttctttcttcttttaaattttacaaaaacaaattgtttattaatttgcagctggtgaaacaaaagaatcgaagacaaacatcggggtagatgg 228  Q
    ||||||||||||||||||||||||||| ||||||  || ||||||||||| ||||||| || ||| |||||||||| ||||||||||||| |||||||||    
36529703 gcacaatttctttcttcttttaaatttcacaaaattaa-ttgtttattaaattgcagccggcgaagcaaaagaatcaaagacaaacatcgaggtagatgg 36529605  T
229 caaagtacgttggtcaggtggaagagcaacatggcgaa 266  Q
    |||||||||||||||||| |||||||||||||||||||    
36529604 caaagtacgttggtcaggcggaagagcaacatggcgaa 36529567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4124 times since January 2019
Visitors: 4827