View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_20 (Length: 268)
Name: NF0744_low_20
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 36529577 - 36529320
Alignment:
Q |
1 |
aacatggcgaatcgtaagtggaaataaaaacgagggtcacaatcctatcataaactattctggcaatggaaaagcgggcaacaatgaaaatcagagtagc |
100 |
Q |
|
|
||||||||||| || |||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| | ||| |
|
|
T |
36529577 |
aacatggcgaagcggaagtggaaatcaaaacgagggtcacaattctatcataaactattctgacaatggaaaagcgggcaacaatgaaaatcagggcagc |
36529478 |
T |
 |
Q |
101 |
agtggaagcggggatagcggtgaaaatagaaatttgggatgcatgtcaaacgtacatggtgaaaaactataagaaaatgctgtgtgttcttaaaatagcc |
200 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
36529477 |
ggtggaagcggggatagcggtggaaatagaaatttgggatgcatgtcaaacgtacatggtgaaaaactataacaaaatgctgtgtgttcttaaaatagcc |
36529378 |
T |
 |
Q |
201 |
taaaaatgcatcatcaccttttacatgaagttgttgtttggaatgattattagtatta |
258 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
36529377 |
taaaaatgcatcatcaccttttacatgaagatgttgtttggaatgattattaatatta |
36529320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University