View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_23 (Length: 265)
Name: NF0744_low_23
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 261
Target Start/End: Complemental strand, 40985968 - 40985737
Alignment:
Q |
30 |
aatatactgtattgaaatgcaattctgtctccagcaggtttatcgagtattgggttcctgctcagttttccagtatgcagcttaagcagtattgttcaat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40985968 |
aatatactgtattgaaatgcaattctgtctccagcaggtttatcgagtattgggttcctgctcagttttccagtatgcagcttaagcagtattgttcaat |
40985869 |
T |
 |
Q |
130 |
gctgctttcaaactcaatgttgttatgctctggccaaaggtctgactctgttggtgccctccgtgagcttgtcatctcaacaaggaaggtaggcacgata |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
40985868 |
gctgctttcaaactcaatgttgttatgctctggccaaaggtctgactctgttggtgccctccgtgagcttgtcatctcaacaaagaaggtaggcacgata |
40985769 |
T |
 |
Q |
230 |
agaagcagataagctgaataagtttggctgtc |
261 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
40985768 |
agaagcagataagctgaataagtttggctgtc |
40985737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University