View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_24 (Length: 257)
Name: NF0744_low_24
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 21344625 - 21344436
Alignment:
Q |
1 |
aaaatttgagtttggatgcctcccacttaaaacacattttaaggcaataatccaacagttatgtcaactacaaagtacacaaaccgcatttgagatggaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
21344625 |
aaaatttgagtttggatgcctcccacttaaaacacattttaaggcaataatccaatagttatgtcaactacaaagtacacaaaccgcatttgagatgaaa |
21344526 |
T |
 |
Q |
101 |
acagcatattattccgattaatttagtacctaaaactactgaatcattgtataatatgaagagagaaaaaataacaataacctaacatgac |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
21344525 |
acagcatattattccgattaatttagtacctaaaactactgaatcattgtctaatatgaaga-aaaaaaaataacaataacctaacatgac |
21344436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University