View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_29 (Length: 242)
Name: NF0744_low_29
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 49774341 - 49774209
Alignment:
Q |
1 |
tctctgcaacaatattggcactcgtattttctttcaccggaggaaggtgggaaagtttcgttgataccagaggagtccggtgatcttgatggtgaagttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49774341 |
tctctgcaacaatattggcactcgtattttctttcaccggaggaaggtgggaaagtttcgttgataccagaggagtccggtgatcttgatggtgaagttg |
49774242 |
T |
 |
Q |
101 |
aggtggaagaagaagttgttttggttgttgttg |
133 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
49774241 |
aggtggaagaagaagttgttttggttgttgttg |
49774209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University