View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0744_low_31 (Length: 239)

Name: NF0744_low_31
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0744_low_31
NF0744_low_31
[»] chr4 (2 HSPs)
chr4 (1-104)||(39287471-39287574)
chr4 (1-104)||(39491461-39491564)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 39287574 - 39287471
Alignment:
1 aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggagtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39287574 aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggggtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg 39287475  T
101 tatt 104  Q
    ||||    
39287474 tatt 39287471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 39491461 - 39491564
Alignment:
1 aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggagtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg 100  Q
    ||||||||||||| ||||||||| ||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
39491461 aaccaacaaatgctatgcttattcagaatgtgtttaggaatggtgtaaaagtgaaatatggggaagatggggttgcaagtgtagaagagattgagaggtg 39491560  T
101 tatt 104  Q
    ||||    
39491561 tatt 39491564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University