View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_31 (Length: 239)
Name: NF0744_low_31
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 39287574 - 39287471
Alignment:
Q |
1 |
aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggagtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39287574 |
aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggggtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg |
39287475 |
T |
 |
Q |
101 |
tatt |
104 |
Q |
|
|
|||| |
|
|
T |
39287474 |
tatt |
39287471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 39491461 - 39491564
Alignment:
Q |
1 |
aaccaacaaatgcaatgcttattgagaatgtgtttaggaatggagtgaaagtgaattatggggaagatggggttgcaagtgtaaaagagattgagaggtg |
100 |
Q |
|
|
||||||||||||| ||||||||| ||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
39491461 |
aaccaacaaatgctatgcttattcagaatgtgtttaggaatggtgtaaaagtgaaatatggggaagatggggttgcaagtgtagaagagattgagaggtg |
39491560 |
T |
 |
Q |
101 |
tatt |
104 |
Q |
|
|
|||| |
|
|
T |
39491561 |
tatt |
39491564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3971 times since January 2019
Visitors: 4825