View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_35 (Length: 228)
Name: NF0744_low_35
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 19172547 - 19172666
Alignment:
| Q |
1 |
taaggaggcgccggagatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttgaatggacgcgacgtc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172547 |
taaggagtcgccggagatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttgaatggacgcgacgtc |
19172646 |
T |
|
| Q |
101 |
gatgatgaagatgatgatgt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19172647 |
gatgatgaagatgatgatgt |
19172666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5290 times since January 2019
Visitors: 4847