View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_low_38 (Length: 207)
Name: NF0744_low_38
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 28845499 - 28845366
Alignment:
| Q |
1 |
aatgcaatgataatttgttgggtgcttnnnnnnnggcaaaaatttatgcttgtggggaatattcatcatctactaacctagagatgtcatcaagttgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||| |||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
28845499 |
aatgcaatgataatttgttgggtgcttaaaaaagggcaaatatttttgcttgtggggaatatttatcatctattaacttagagatgccatcaagttgcaa |
28845400 |
T |
|
| Q |
101 |
cgaagagtcaatacaacaattggtctgtcctatg |
134 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
28845399 |
cgaagagtcaatacaacaattggtacgtcctatg |
28845366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5376 times since January 2019
Visitors: 4850