View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_high_12 (Length: 312)

Name: NF0745_high_12
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_high_12
NF0745_high_12
[»] chr2 (1 HSPs)
chr2 (116-287)||(34348525-34348696)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 116 - 287
Target Start/End: Original strand, 34348525 - 34348696
Alignment:
116 cctgttgaatctctgatggagctccacttttcatgtatggtgtgctcaaaacctgttgataaaaatatattcataaaatgaattttatgnnnnnnngtgc 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||       ||||    
34348525 cctgttgaatctctgatggagctccacttttcatgtatggtgtgctcaaaacctgttgataaaaatatattcattaaatgaattttatgtttttttgtgc 34348624  T
216 taaatatgtttttaatctcatagaatgccatcatatcaagtttagccatattgctatgctaaaattagtgat 287  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
34348625 taaatatgtttttaatctcataaaatgccatcatatcaagtttagccatattgctatgctaaaattagtgat 34348696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4814 times since January 2019
Visitors: 4839