View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_high_15 (Length: 285)
Name: NF0745_high_15
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 45 - 222
Target Start/End: Complemental strand, 24347512 - 24347335
Alignment:
| Q |
45 |
ataattctagaattatgtgtggtttaatgcgtagacaacctgaaagttgctcaaataaaacacagcttctccttccatgccggcacatgcaatcatgaga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24347512 |
ataattctagaattatgtgtggtttaatgcctagataacctgaaagttgctcaaataaaacacagcttctccttccatgctggcacatgcaatcatgaga |
24347413 |
T |
 |
| Q |
145 |
gactcgtcacgtgtcattacatctggttcatacaatccacttcgaacaacaatccaacatggacactcacccattagt |
222 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24347412 |
gacttatcatgtgtcattacaactggttcatacaatccacttcgaacaacaatccaacatggacactcacccattagt |
24347335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University