View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_high_19 (Length: 250)
Name: NF0745_high_19
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 43802318 - 43802559
Alignment:
Q |
1 |
catcataatgagaatacaagcaacgtttcacatcataatgatggatgcagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcacca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43802318 |
catcataatgagaatacaagcaacgtttcacatcataatgatggatgcagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcacca |
43802417 |
T |
 |
Q |
101 |
acaaagtttttgcattgtagtattataaatattaaaattaaaactg-nnnnnnnnnttgtattaca---tcaagaaaaagagattgcaatccagttagtt |
196 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
43802418 |
acaaagtttttgcattgaagtattataaatattaaaattaaaactgaaaaaaaaaattgtattacatcttcaagaaaaagagattgcaatccagttagtt |
43802517 |
T |
 |
Q |
197 |
gaaaaataaggtggaacattagagtctctcacgcttgatatt |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43802518 |
gaaaaataaggtggaacattagagtctctcacgcttgatatt |
43802559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4627 times since January 2019
Visitors: 4836