View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_high_8 (Length: 380)
Name: NF0745_high_8
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 83 - 361
Target Start/End: Complemental strand, 33185431 - 33185153
Alignment:
Q |
83 |
ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33185431 |
ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa |
33185332 |
T |
 |
Q |
183 |
ttagggtatgcttgaattttgggtctttttcagattcttgnnnnnnnntggtattttgttgtcttgattaagggcttttgataataatttgattgtttcc |
282 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
33185331 |
ttagggtatgcttgaattttgggtctttttcagattcttgaaaaaaaatggtattttgttgtcttgattaagggtttttgataataatttgattgtttcc |
33185232 |
T |
 |
Q |
283 |
caaataccaattttggatttttcagtttgatttctgaattgaatttagtaaatattccaaatgcaaatttcgagttttt |
361 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| ||||| |
|
|
T |
33185231 |
caaataccaattttggatttttcagtttgatttctgaattgcatttggtaaacattccaaatgcaaatttcgatttttt |
33185153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 214
Target Start/End: Complemental strand, 32273380 - 32273327
Alignment:
Q |
160 |
gatttttcagtttgttttctgaattagggtatgcttgaattttgggtctttttca |
214 |
Q |
|
|
||||||||||||||| |||| |||| |||||||||||||||||| |||| ||||| |
|
|
T |
32273380 |
gatttttcagtttgtgttctaaatt-gggtatgcttgaattttgagtctctttca |
32273327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 311
Target Start/End: Complemental strand, 32273401 - 32273367
Alignment:
Q |
277 |
gtttcccaaataccaattttggatttttcagtttg |
311 |
Q |
|
|
||||||||||| ||||||||||||||||||||||| |
|
|
T |
32273401 |
gtttcccaaatgccaattttggatttttcagtttg |
32273367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University