View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_11 (Length: 413)
Name: NF0745_low_11
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 82 - 384
Target Start/End: Complemental strand, 34336230 - 34335928
Alignment:
| Q |
82 |
aatataacccccacaataagaaaacgtgagaaattcattctataaatatgcaaacatcacacataacaaacacaattttccaaaagaaaaatagatgaag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34336230 |
aatataacccccacaataagaaaacgtgagaaattcattctataaatatgcaaacatcacacataacaaacacaattttccaaaagaaaaatagatgaag |
34336131 |
T |
 |
| Q |
182 |
ctacagatccaaatcctttcataaagatcttgtttcatttacataaaaataaacctacacattaacgatgtcaccttcaatgtttgtttcaccgaaaatc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34336130 |
ctacagatccaaatcctttcataaagatcttgtttcatttacataaaaataaacctacacattaacgatgtcaccttcaatgtttttttcaccgaaaatc |
34336031 |
T |
 |
| Q |
282 |
attgtcgtgatgtttgttttggccatgataacatgtgtccctgccaaagccagcaccatagaacattgtctaaggttgaaactgaatccacctccaccag |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34336030 |
attgtcgtgatgtttgttttggccatgataacatgtgtccctgccaaagccagcaccatagaacattgtttaaggttgaaactgaatccacctccaccag |
34335931 |
T |
 |
| Q |
382 |
cac |
384 |
Q |
| |
|
||| |
|
|
| T |
34335930 |
cac |
34335928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 249 - 316
Target Start/End: Complemental strand, 34338572 - 34338505
Alignment:
| Q |
249 |
atgtcaccttcaatgtttgtttcaccgaaaatcattgtcgtgatgtttgttttggccatgataacatg |
316 |
Q |
| |
|
||||||||||| |||| | |||||| ||||||||||| ||| ||||||||| ||||||||| ||||| |
|
|
| T |
34338572 |
atgtcaccttcgatgtatttttcacgtaaaatcattgttgtggtgtttgtttcggccatgatgacatg |
34338505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University