View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_12 (Length: 380)

Name: NF0745_low_12
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_12
NF0745_low_12
[»] chr5 (3 HSPs)
chr5 (83-361)||(33185153-33185431)
chr5 (160-214)||(32273327-32273380)
chr5 (277-311)||(32273367-32273401)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 83 - 361
Target Start/End: Complemental strand, 33185431 - 33185153
Alignment:
83 ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33185431 ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa 33185332  T
183 ttagggtatgcttgaattttgggtctttttcagattcttgnnnnnnnntggtattttgttgtcttgattaagggcttttgataataatttgattgtttcc 282  Q
    ||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||| |||||||||||||||||||||||||    
33185331 ttagggtatgcttgaattttgggtctttttcagattcttgaaaaaaaatggtattttgttgtcttgattaagggtttttgataataatttgattgtttcc 33185232  T
283 caaataccaattttggatttttcagtttgatttctgaattgaatttagtaaatattccaaatgcaaatttcgagttttt 361  Q
    ||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| |||||    
33185231 caaataccaattttggatttttcagtttgatttctgaattgcatttggtaaacattccaaatgcaaatttcgatttttt 33185153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 214
Target Start/End: Complemental strand, 32273380 - 32273327
Alignment:
160 gatttttcagtttgttttctgaattagggtatgcttgaattttgggtctttttca 214  Q
    ||||||||||||||| |||| |||| |||||||||||||||||| |||| |||||    
32273380 gatttttcagtttgtgttctaaatt-gggtatgcttgaattttgagtctctttca 32273327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 311
Target Start/End: Complemental strand, 32273401 - 32273367
Alignment:
277 gtttcccaaataccaattttggatttttcagtttg 311  Q
    ||||||||||| |||||||||||||||||||||||    
32273401 gtttcccaaatgccaattttggatttttcagtttg 32273367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University