View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_13 (Length: 344)
Name: NF0745_low_13
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 74 - 252
Target Start/End: Original strand, 13135452 - 13135630
Alignment:
| Q |
74 |
gtgagatgaaaaatcatgaagaagaaacatgggaaaacacaagtctaaacacaatttgcaaatgttgttattcacaagagtcatcttttatgttccttcc |
173 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13135452 |
gtgacatgaaaaatcatgaagaagaaacatgggaaaacacaagtctaaacacaatttgcaaatgttgttattcacaagagtcatcttttatgttccttcc |
13135551 |
T |
|
| Q |
174 |
ttgcaggcacctatgttcttgtaaatcatgtgaaccttctctccaaacatgtcctgtgtgcttaatgccaaagagatct |
252 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13135552 |
ttgcaggcacctatgttcatgtaaatcatgtgaaccttctctccaaacatgtcctgtgtgcttaatgccaaagagatct |
13135630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 55209016 - 55209141
Alignment:
| Q |
127 |
atttgcaaatgttgttattcacaaga-gtcatcttttatgttccttccttgcaggcacctatgttcttgtaaatcatgtgaaccttctctccaaacatgt |
225 |
Q |
| |
|
||||||||||||||| ||||| | || ||| |||||||||||||||||||||||||| || ||||| |||||| | |||||||||||||||||| ||||| |
|
|
| T |
55209016 |
atttgcaaatgttgtcattca-aggatgtcgtcttttatgttccttccttgcaggcatctttgttcgtgtaaagcgtgtgaaccttctctccaagcatgt |
55209114 |
T |
|
| Q |
226 |
cctgtgtgcttaatgccaaagagatct |
252 |
Q |
| |
|
||||||||| | ||||||||||||||| |
|
|
| T |
55209115 |
cctgtgtgcctcatgccaaagagatct |
55209141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4359 times since January 2019
Visitors: 4835