View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_14 (Length: 342)
Name: NF0745_low_14
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 95 - 259
Target Start/End: Original strand, 43093057 - 43093221
Alignment:
| Q |
95 |
actcaaaatgtttgatatatatgtcaagagatcaaccatatgtatataaacgataagaggctaaatgagacctgaatttcttgccaagaaaaagaatctc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43093057 |
actcaaaatgtttgatatatatgtcaagagatcaaccatatgtatataaacgataagaggctaaatgagacctgaatttctttccaagaaaaagaatctc |
43093156 |
T |
|
| Q |
195 |
cagtagaatagtacacggaattattgccaactttgtcatctgaatgcatatgtaaaagagtctgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43093157 |
cagtagaatagtacacggaattattgccaactttgtcatctgaatgcatatgtaaaagagtctgt |
43093221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4343 times since January 2019
Visitors: 4832