View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_15 (Length: 334)
Name: NF0745_low_15
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 46 - 256
Target Start/End: Original strand, 35244759 - 35244969
Alignment:
| Q |
46 |
aatattctcactatgttcattgaaaatttgcaaatggattgtgattcttaaaatgcttttatgtattttttcttgtctaggattgggactcacaaaacgc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35244759 |
aatattctcactatgttcattgaaaatttgcaaatggattgtgattcttaaaatgcttttatgtattttttcttgtctaggactgggactcacaaaacgc |
35244858 |
T |
 |
| Q |
146 |
atcacaaattgctactgagttatgtggctttgtcacaattttatcaggaacatttctccttcacaagacaaaagatatgggaaataaacaacccgaacaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35244859 |
atcacaaattgctactgagttatgtggctttgtcacaattttatcaggaacatttctccttcacaagacaaaagatatgggaaataaaccacccgaacaa |
35244958 |
T |
 |
| Q |
246 |
tctcctgcttc |
256 |
Q |
| |
|
||||||||||| |
|
|
| T |
35244959 |
tctcctgcttc |
35244969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 234
Target Start/End: Complemental strand, 37890219 - 37890109
Alignment:
| Q |
124 |
aggattgggactcacaaaacgcatcacaaattgctactgagttatgtggctttgtcacaattttatcaggaacatttctccttcacaagacaaaagatat |
223 |
Q |
| |
|
|||| |||||||||||| | || || || |||| || ||||| || || ||||| ||||||||||| || ||||| ||||||||||| || || ||||| |
|
|
| T |
37890219 |
aggaatgggactcacaagatgcgtctcagattgtgacagagttgtgcgggtttgtgacaattttatctgggacattcctccttcacaaaactaaggatat |
37890120 |
T |
 |
| Q |
224 |
gggaaataaac |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
37890119 |
gggaaataaac |
37890109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University