View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_17 (Length: 327)
Name: NF0745_low_17
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 33398512 - 33398803
Alignment:
Q |
1 |
taaacaatatcattgcacttgatacagacataaaatat--tttctgactttgcaatttggtttatattatctttttcacaaatacattgaaaagaagaga |
98 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33398512 |
taaacaatatcattgcacttgatatagacataaaatatattttctgactttgcaatttggtttatattatctttttcacaaatacattgaaaagaagaga |
33398611 |
T |
 |
Q |
99 |
aacttttagttatgcattattagtatttaatttttcattctttgctttctctcacatatgaattgttggaacaaaatgtgtaattgaaaacttcctagaa |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
33398612 |
aacttttagttatgcattattagtatttaatttttcattctttgctttctctcacatatgaattgttggaacaaaatgtgtaattgaaaagttcctagaa |
33398711 |
T |
 |
Q |
199 |
gtcccggataagagagacttcataca------------atatagtgaaggtatgcctcattggggtgttatccaagagttaccgaattttgt |
278 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33398712 |
gtcccggataagagagacttcacacaacacatgggtttatatagtgaaggtatgcctcattggggtgttatccaagagttaccgaattttgt |
33398803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3714 times since January 2019
Visitors: 4818