View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_19 (Length: 323)
Name: NF0745_low_19
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 101 - 246
Target Start/End: Complemental strand, 38630261 - 38630116
Alignment:
Q |
101 |
atgtcttctccatttttctttctatacaaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgc |
200 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38630261 |
atgtcttctccatttttctttctataccaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgc |
38630162 |
T |
 |
Q |
201 |
tacggcatctattcattgatagtgaaaaccaaaatcaatattcttc |
246 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38630161 |
tacggcatctattcattgatagtgaaaaccaaaatcaatattcttc |
38630116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 38695745 - 38695825
Alignment:
Q |
144 |
tcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgctacggcatctattcattgatagtgaaa |
227 |
Q |
|
|
|||| |||| ||| |||||||||| |||||| | ||||||||||||||||| ||||||| ||| |||| ||||||||||||| |
|
|
T |
38695745 |
tcaccaatgcatcgtgtctatagg---atctgccttgcgctagttcacataccctgctacgacatgtatttattgatagtgaaa |
38695825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University