View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_21 (Length: 318)
Name: NF0745_low_21
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 74 - 318
Target Start/End: Complemental strand, 40936472 - 40936228
Alignment:
| Q |
74 |
agcagcagagacttgcatttttcttctccctgggtgtttgctgcggcgtggatgtttgctgcacatactctgatagagggaggtagttaaagttcaaagg |
173 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40936472 |
agcagcacagacttgcatttttcttctccctgggtgtttgctgcggcgtggatgtttgctgcacatactctgatagagggaggtagttaaagttcaaagg |
40936373 |
T |
|
| Q |
174 |
gctaggtggaggttgtagttggaggtggctgcgaggaggatgaggtcatcattgctaaaggagcaagagagttctgagagctatgtagtgttgggagggg |
273 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40936372 |
gctaggtggaggttgtggttggaggtggctgcgaggaggatgaggtcatcattgctaaaggagcaagagagttctgagagctatgttgtgttgggagggg |
40936273 |
T |
|
| Q |
274 |
gtggctaggaggatgaggttgccattgggctaagatgattggatc |
318 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40936272 |
gtgggtaggaggatgaggttgccattgggctaagatgattggatc |
40936228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4881 times since January 2019
Visitors: 4840