View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_24 (Length: 312)
Name: NF0745_low_24
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 116 - 287
Target Start/End: Original strand, 34348525 - 34348696
Alignment:
Q |
116 |
cctgttgaatctctgatggagctccacttttcatgtatggtgtgctcaaaacctgttgataaaaatatattcataaaatgaattttatgnnnnnnngtgc |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
T |
34348525 |
cctgttgaatctctgatggagctccacttttcatgtatggtgtgctcaaaacctgttgataaaaatatattcattaaatgaattttatgtttttttgtgc |
34348624 |
T |
 |
Q |
216 |
taaatatgtttttaatctcatagaatgccatcatatcaagtttagccatattgctatgctaaaattagtgat |
287 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34348625 |
taaatatgtttttaatctcataaaatgccatcatatcaagtttagccatattgctatgctaaaattagtgat |
34348696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University