View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_28 (Length: 300)
Name: NF0745_low_28
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0745_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 29 - 231
Target Start/End: Complemental strand, 26406714 - 26406512
Alignment:
| Q |
29 |
cacagacgcaacaatacaacatgtttgtgtcttgnnnnnnnatttactcattacttaggcttttgttcatcgttagttattgaccttattttgttggtgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26406714 |
cacagacgcaacaatacaacatgtttgtgtcttgtttttttatttactcattacttaggtttttgttcatcgttagttattgaccttatttcgttggtgg |
26406615 |
T |
|
| Q |
129 |
ccgggtttcaacccaagacttttccatatattatatattgtctctgacaactaataagttaagttcatcagaacactctagttatagttctggcagttac |
228 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26406614 |
ccgggtttcaacctcagacctttccatatattatgtattgtctctgacaattaataagttaagttcatcagaacactctagttatagttctggcagttac |
26406515 |
T |
|
| Q |
229 |
ttg |
231 |
Q |
| |
|
||| |
|
|
| T |
26406514 |
ttg |
26406512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4312 times since January 2019
Visitors: 4832