View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_31 (Length: 272)

Name: NF0745_low_31
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_31
NF0745_low_31
[»] chr1 (1 HSPs)
chr1 (49-231)||(44843344-44843526)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 49 - 231
Target Start/End: Original strand, 44843344 - 44843526
Alignment:
49 agagagagtgtggttaatggttatagggttagacttagagataaagcatttatattgaactcaaagcgctaaaatctctcgaagactataccgaattctt 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44843344 agagagagtgtggttaatggttatagggttagacttagagataaagcatttatattgaactcaaagcgctaaaatctctcgaagactataccgaattctt 44843443  T
149 aaagatagagctgcatattgttattcccaactaaattgccaacgagacacataactctcaatagtcgatactcatgtgagaat 231  Q
    ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
44843444 aaagatagagctgcatattgttactcccaactaaattgccaacgacacacataactctcaatagtcaatactcatgtgagaat 44843526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University