View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_31 (Length: 272)
Name: NF0745_low_31
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 49 - 231
Target Start/End: Original strand, 44843344 - 44843526
Alignment:
Q |
49 |
agagagagtgtggttaatggttatagggttagacttagagataaagcatttatattgaactcaaagcgctaaaatctctcgaagactataccgaattctt |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44843344 |
agagagagtgtggttaatggttatagggttagacttagagataaagcatttatattgaactcaaagcgctaaaatctctcgaagactataccgaattctt |
44843443 |
T |
 |
Q |
149 |
aaagatagagctgcatattgttattcccaactaaattgccaacgagacacataactctcaatagtcgatactcatgtgagaat |
231 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
T |
44843444 |
aaagatagagctgcatattgttactcccaactaaattgccaacgacacacataactctcaatagtcaatactcatgtgagaat |
44843526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University