View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_35 (Length: 250)

Name: NF0745_low_35
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_35
NF0745_low_35
[»] chr4 (1 HSPs)
chr4 (1-238)||(43802318-43802559)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 43802318 - 43802559
Alignment:
1 catcataatgagaatacaagcaacgtttcacatcataatgatggatgcagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43802318 catcataatgagaatacaagcaacgtttcacatcataatgatggatgcagtggtgaccctaagaacgggtgggatgggctctaacttttcagaggcacca 43802417  T
101 acaaagtttttgcattgtagtattataaatattaaaattaaaactg-nnnnnnnnnttgtattaca---tcaagaaaaagagattgcaatccagttagtt 196  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||          ||||||||||   |||||||||||||||||||||||||||||||    
43802418 acaaagtttttgcattgaagtattataaatattaaaattaaaactgaaaaaaaaaattgtattacatcttcaagaaaaagagattgcaatccagttagtt 43802517  T
197 gaaaaataaggtggaacattagagtctctcacgcttgatatt 238  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43802518 gaaaaataaggtggaacattagagtctctcacgcttgatatt 43802559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University