View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_44 (Length: 203)

Name: NF0745_low_44
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_44
NF0745_low_44
[»] chr7 (1 HSPs)
chr7 (1-34)||(44767100-44767133)


Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 44767100 - 44767133
Alignment:
1 gcggaaggaattcgcgggaaattaatctccatgg 34  Q
    ||||||||||||||||||||||||||||||||||    
44767100 gcggaaggaattcgcgggaaattaatctccatgg 44767133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4601 times since January 2019
Visitors: 4836