View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0745_low_44 (Length: 203)
Name: NF0745_low_44
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0745_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 44767100 - 44767133
Alignment:
Q |
1 |
gcggaaggaattcgcgggaaattaatctccatgg |
34 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
44767100 |
gcggaaggaattcgcgggaaattaatctccatgg |
44767133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University