View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0745_low_46 (Length: 201)

Name: NF0745_low_46
Description: NF0745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0745_low_46
NF0745_low_46
[»] chr4 (1 HSPs)
chr4 (1-98)||(53233702-53233799)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 53233702 - 53233799
Alignment:
1 tatttcgtcggattgaattggttcattgattttggtttctgaaacacaatctgtggaatttttattgttcttgtttgataaacctcctatgggaagag 98  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53233702 tatttcgtcggattgaattggttcattgattttggtttctgatacacaatctgtggaatttttattgttcttgtttgataaacctcctatgggaagag 53233799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5091 times since January 2019
Visitors: 4845