View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_high_12 (Length: 251)
Name: NF0746_high_12
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_high_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 27361264 - 27361023
Alignment:
| Q |
9 |
gaagaatattgacactaacatttttagaccaacttctgttttagtttttccatgaagtaaatataaactcttgtgtgtttttaaattgttgtcgttttag |
108 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27361264 |
gaagaatattgacactaacattttttttc-aacttctgttttagtttttccatgaagtaaatataaactcttgtgtgtttttaaattattgtcgttttag |
27361166 |
T |
|
| Q |
109 |
aagagaaaaaataaactatttcaaatactcccataaaattgtatagtccactgtgagcaaaaaggtttatggactgtgttatctgcactagtgctgtgcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27361165 |
aagagaaaaaataaactatttcaaatactcccataaaattgtacagtccactgtgagcaaaaaggtttatggactgtgttatctgcactagtgctgtgcc |
27361066 |
T |
|
| Q |
209 |
taatccttttatattgtttggcaaggtttttccaccgaattat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27361065 |
taatccttttatattgtttggcaaggtttttccaccgaattat |
27361023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5633 times since January 2019
Visitors: 4857