View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_high_13 (Length: 251)
Name: NF0746_high_13
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0746_high_13 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 27361260 - 27361023
Alignment:
Q |
13 |
aatattgacactaacatttttagaccaacttctgttttagtttttccatgaagtaaatataaactcttgtgtgtttttaaattgttgtcgttttagaaga |
112 |
Q |
|
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
27361260 |
aatattgacactaacattttttttc-aacttctgttttagtttttccatgaagtaaatataaactcttgtgtgtttttaaattattgtcgttttagaaga |
27361162 |
T |
 |
Q |
113 |
gaaaaaataaactatttcaaatactcccataaaattgtatagtccactgtgagcaaaaaggtttatggactgtgttatctgcactagtgctgtgcctaat |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27361161 |
gaaaaaataaactatttcaaatactcccataaaattgtacagtccactgtgagcaaaaaggtttatggactgtgttatctgcactagtgctgtgcctaat |
27361062 |
T |
 |
Q |
213 |
ccttttatattgtttggcaaggtttttccaccgaattat |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27361061 |
ccttttatattgtttggcaaggtttttccaccgaattat |
27361023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5804 times since January 2019
Visitors: 4859