View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_high_15 (Length: 241)
Name: NF0746_high_15
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_high_15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 31617307 - 31617534
Alignment:
| Q |
14 |
agacaaaggaaggtacaagataaagacaatattagctttagttattgctttagcttttttgattatagggtttatctacaagggttttgagcaagagtga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31617307 |
agacaaaggaaggtacaagataaagacaatattagctttagttattgctttagcttttttgattatagggtttatctacaagggttttgagcaagagtga |
31617406 |
T |
|
| Q |
114 |
agcacatggagttcaataaaagtagtcttcaactcttttgcataaagtagagcacacaataaaggaatggtaggtttaggnnnnnnnnnnccttaatgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31617407 |
agcacatggagttcaataaaagtagtcttcaactcttttgcataaagtagagcacacaataaaggaatggtaggtttaggttttttttttccttaatgaa |
31617506 |
T |
|
| Q |
214 |
tacggaaggacaagttagtttttgaaag |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
31617507 |
tacggaaggacaggttagtttttgaaag |
31617534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5369 times since January 2019
Visitors: 4850