View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_15 (Length: 329)
Name: NF0746_low_15
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 505151 - 504941
Alignment:
| Q |
20 |
agagaaattgtcagctatactccattgaattaataaaatgaagtcaagatnnnnnnncaaagtgactcgagtgagttgacagaaattgtgtgggttaggt |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505151 |
agagaaattgtcagctatactccatcgaattaataaaatgaagtcaagataaaaaaacaaagtgactcgagtgagttgacagaaattgtgtgggttaggt |
505052 |
T |
 |
| Q |
120 |
gcaaaattataattttagagggttcaatatatcnnnnnnnnnnnnnnnnnttggtgaaactttctaaaattcagaagattcatgtgaatccccttacacc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
505051 |
gcaaaattataattttagagggttcaatatatcaaaaaataaaaataaaattggtgaaactttctaaaattcagaagattcatgtgaatcccctcacacc |
504952 |
T |
 |
| Q |
220 |
tatgtggctcc |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
504951 |
tatgtggctcc |
504941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University