View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_18 (Length: 320)
Name: NF0746_low_18
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0746_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 106 - 207
Target Start/End: Complemental strand, 11918452 - 11918351
Alignment:
Q |
106 |
atcaaagtaacagctaggacaactattatgttgactaaatcatagttatctattatctacctactctaccctttattaggtcttaaggtataactttatt |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11918452 |
atcaaagtaacagctaggacaactattatgttgactaaatcatagttatctattatctacctactctaccctttattaggtcttaaggtataactttatt |
11918353 |
T |
 |
Q |
206 |
gc |
207 |
Q |
|
|
|| |
|
|
T |
11918352 |
gc |
11918351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University