View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_21 (Length: 310)
Name: NF0746_low_21
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7348361 - 7348309
Alignment:
| Q |
157 |
tagaaggagaagatgttgaagaggaagaaccagtgatgattgtaattgataag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7348361 |
tagaaggagaagatgttgaagaggaagaaccggtgatgattgtaattgataag |
7348309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5546 times since January 2019
Visitors: 4857