View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_28 (Length: 251)
Name: NF0746_low_28
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 47852123 - 47852365
Alignment:
| Q |
1 |
atttcaatgacactttttcttgtgattccggaaagtatggttccactgatagcaggcgttgaaatggttttgccctaagaaattgaaatccaagttagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47852123 |
atttcaatgacactttttcttgtgattccggaaagtatggttccactgatagcaggcgttgaaatggttttgccctaagaaattgaaatccaagttagat |
47852222 |
T |
|
| Q |
101 |
cgagatcgtttgaccagttgcaaatataacagatagaatatagtacatattgagtttcaccaaatcagttagaacatgcacaactaggaaagtaacaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47852223 |
tgagatcgtttgaccagttgcaaatataacagatagaatatagtacatattgagtttcaccaaatcagttagaacatgcacaactaggaaagtaacaatt |
47852322 |
T |
|
| Q |
201 |
catgcgattatccgaaaaccagaatttaaataaaccctatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47852323 |
catgcgattatccgaaaaccagaatttaaataaaccctatgct |
47852365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5266 times since January 2019
Visitors: 4847