View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0746_low_28 (Length: 251)

Name: NF0746_low_28
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0746_low_28
NF0746_low_28
[»] chr3 (1 HSPs)
chr3 (1-243)||(47852123-47852365)


Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 47852123 - 47852365
Alignment:
1 atttcaatgacactttttcttgtgattccggaaagtatggttccactgatagcaggcgttgaaatggttttgccctaagaaattgaaatccaagttagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47852123 atttcaatgacactttttcttgtgattccggaaagtatggttccactgatagcaggcgttgaaatggttttgccctaagaaattgaaatccaagttagat 47852222  T
101 cgagatcgtttgaccagttgcaaatataacagatagaatatagtacatattgagtttcaccaaatcagttagaacatgcacaactaggaaagtaacaatt 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47852223 tgagatcgtttgaccagttgcaaatataacagatagaatatagtacatattgagtttcaccaaatcagttagaacatgcacaactaggaaagtaacaatt 47852322  T
201 catgcgattatccgaaaaccagaatttaaataaaccctatgct 243  Q
    |||||||||||||||||||||||||||||||||||||||||||    
47852323 catgcgattatccgaaaaccagaatttaaataaaccctatgct 47852365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University