View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0746_low_29 (Length: 243)

Name: NF0746_low_29
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0746_low_29
NF0746_low_29
[»] chr7 (1 HSPs)
chr7 (16-131)||(25049172-25049287)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 25049172 - 25049287
Alignment:
16 taaagaatttactacaattcagagaagtaaaatgttcttcttttttaattgcatttgtaaaactaaaattatcacttcaattttcttcaagtcttataat 115  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25049172 taaagaatttactacaattcagaggagtaaaatgttcttcttttttaattgcatttgtaaaactaaaattatcacttcaattttcttcaagtcttataat 25049271  T
116 taacaaccgtgttatc 131  Q
    ||||||||||||||||    
25049272 taacaaccgtgttatc 25049287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University