View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_29 (Length: 243)
Name: NF0746_low_29
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0746_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 25049172 - 25049287
Alignment:
| Q |
16 |
taaagaatttactacaattcagagaagtaaaatgttcttcttttttaattgcatttgtaaaactaaaattatcacttcaattttcttcaagtcttataat |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049172 |
taaagaatttactacaattcagaggagtaaaatgttcttcttttttaattgcatttgtaaaactaaaattatcacttcaattttcttcaagtcttataat |
25049271 |
T |
 |
| Q |
116 |
taacaaccgtgttatc |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25049272 |
taacaaccgtgttatc |
25049287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University