View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_35 (Length: 210)
Name: NF0746_low_35
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0746_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 103 - 198
Target Start/End: Complemental strand, 6515837 - 6515741
Alignment:
Q |
103 |
actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtg-tggtccctt |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
6515837 |
actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtgttggtccctt |
6515741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 104
Target Start/End: Complemental strand, 6515970 - 6515926
Alignment:
Q |
60 |
ttttgtgtttgatttctatgttgttgggtatggatcatctgcaac |
104 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6515970 |
ttttttgtttgatttctatgttgttgggtatggatcatctgcaac |
6515926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University