View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0746_low_35 (Length: 210)

Name: NF0746_low_35
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0746_low_35
NF0746_low_35
[»] chr2 (2 HSPs)
chr2 (103-198)||(6515741-6515837)
chr2 (60-104)||(6515926-6515970)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 103 - 198
Target Start/End: Complemental strand, 6515837 - 6515741
Alignment:
103 actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtg-tggtccctt 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
6515837 actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtgttggtccctt 6515741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 104
Target Start/End: Complemental strand, 6515970 - 6515926
Alignment:
60 ttttgtgtttgatttctatgttgttgggtatggatcatctgcaac 104  Q
    |||| ||||||||||||||||||||||||||||||||||||||||    
6515970 ttttttgtttgatttctatgttgttgggtatggatcatctgcaac 6515926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University