View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0746_low_9 (Length: 378)
Name: NF0746_low_9
Description: NF0746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0746_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 123 - 350
Target Start/End: Complemental strand, 27360888 - 27360664
Alignment:
Q |
123 |
ccatataataaagtgtggtattattactactagtgatgacaaatgagtgtggtgtatatccttcctcgtctagttgactcagttatggtccacctttgat |
222 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
27360888 |
ccatataataaagtgtggtatta---ctactagtgatgacaaatgagtgtggtgtatatccttcctcgtctagttgactcggttatggtccacctttgat |
27360792 |
T |
 |
Q |
223 |
ggttaagtttgcaagtggccttttggactaatttacaaaataaaacatcaaagcttctattcaatatcctattttgatcaatatctgcagatgtcaaata |
322 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27360791 |
ggttaagtttgcaagtggccttttggactaattcacaaaataaaacatcaaagcttctattcaatatcctattttgatcaatatctgcagatgtcaaata |
27360692 |
T |
 |
Q |
323 |
aaagatgcaaagctagttagttaagtgt |
350 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
27360691 |
aaagatgcaaagctagttagttaagtgt |
27360664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 27361010 - 27360966
Alignment:
Q |
1 |
tattccatccatctatctaatcgaccatgtccaacttgacaagag |
45 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27361010 |
tattccatccatctatctaatcgaccatgtccaacttgacaagag |
27360966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4489 times since January 2019
Visitors: 4835