View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_high_12 (Length: 272)
Name: NF0747_high_12
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_high_12 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 30 - 272
Target Start/End: Original strand, 14192097 - 14192340
Alignment:
Q |
30 |
ttctcttctaattctaaattctaactcaccacatatttt-ttctttgtttgaaagatggcagtcatccctaacaggcaagcagcgttggagtctagactt |
128 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||| ||| |||||||| |||||||||||||||| |
|
|
T |
14192097 |
ttctgttctaattctaaattctaactcaccacatatttttttctttgtttgaaagatggcaattatcccttacatgcaagcagtgttggagtctagactt |
14192196 |
T |
 |
Q |
129 |
tacgaagaagttcatccatgcagcatttgcagggttccnnnnnnncttcgagacctaaaaaaggacgcttacacgccaaagtctatctttatagggttct |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
T |
14192197 |
tacgaagaagttcatccatgcagcatttgcagggttccaaacaaacttcgagacctaaaagaggacgcttacacgccaaagtctatctttataggactct |
14192296 |
T |
 |
Q |
229 |
tacccaggggagaaacgagctaccaccaagtccaattgatggta |
272 |
Q |
|
|
|||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
14192297 |
tacccaggggagaaacgaactaccgccaagtccaattgatggta |
14192340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University