View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_high_14 (Length: 263)
Name: NF0747_high_14
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 254
Target Start/End: Complemental strand, 26593513 - 26593264
Alignment:
Q |
5 |
tttactctgtttaggggagactttaccacaagagaccttggtaggcttaatctacataaacttgttagacgaaatgcttgattccctcatctttgccatg |
104 |
Q |
|
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26593513 |
tttactctatttaggagagactttaccacaagagaccttggtaggcttaatctacataaacttgttagacgaaatgcttgattccctcatctttgccatg |
26593414 |
T |
 |
Q |
105 |
tcaaaactcggatactccaagacataaaagaacctgacttgaacgtttacaacgcggccacaaacaatctcaatctcatccaaagaatgacaacaaaacc |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
26593413 |
tcaaaactcggatactccaagacataaaagaacctgacgtgaacgtttacaacgcagccacaaacaatcccaatctcatccaaagaatgacaacaaaacc |
26593314 |
T |
 |
Q |
205 |
accaatcgaaacaccaatgtgccctggtgtccccatacccaccttcatct |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26593313 |
accaatcgaaacaccaatgtgccctggtgtccccatacccaccttcatct |
26593264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 121
Target Start/End: Complemental strand, 34750155 - 34750052
Alignment:
Q |
20 |
ggagactttaccacaagagaccttggtag--gcttaatctacataaacttgttagacgaaatgcttgattccctcatctttgccatgtcaaaactcggat |
117 |
Q |
|
|
||||| || ||||||||||||| || ||| |||||||||||| ||||||||||||| |||||||||| |||||| |||||||||||||||||||||||| |
|
|
T |
34750155 |
ggagatttcaccacaagagaccctgatagtggcttaatctacagaaacttgttagaccaaatgcttgactccctcctctttgccatgtcaaaactcggat |
34750056 |
T |
 |
Q |
118 |
actc |
121 |
Q |
|
|
|||| |
|
|
T |
34750055 |
actc |
34750052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4758 times since January 2019
Visitors: 4839