View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_high_17 (Length: 251)
Name: NF0747_high_17
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_high_17 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 11759010 - 11759132
Alignment:
Q |
124 |
cattgttcaattgctttgatatggttttgttaattaagacattgaaacagtgacatggttggaaatggaatggagaattgaaacagagttaggctttgcg |
223 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
11759010 |
cattgtttaattgctttgatatggttttgttaattaagaaattgaaacagtgacatggttgga-----aatggagaattgaaacagagttaggctttgcg |
11759104 |
T |
 |
Q |
224 |
tttgaatgtcgttgttatttttatttat |
251 |
Q |
|
|
||||||||| || ||||||||||||||| |
|
|
T |
11759105 |
tttgaatgtagtagttatttttatttat |
11759132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4168 times since January 2019
Visitors: 4829