View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_high_22 (Length: 228)
Name: NF0747_high_22
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0747_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 2874729 - 2874873
Alignment:
| Q |
1 |
ctcataactagagaaactctagtaaccaactctaataatacatcagaatgccttctccactatccatcccctctcttttatctccgtactcacatgagat |
100 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2874729 |
ctcataactagcgaagctctagtaaccaactctaataatacatcagaatgccttctccactatccatcccctctcttttatctccgtactcacatgagat |
2874828 |
T |
|
| Q |
101 |
tggtgcacaagtcactaacctatgaagcacgaacacctctaggat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2874829 |
tggtgcacaagtcactaacctatgaagcacggacacctctaggat |
2874873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 3160313 - 3160178
Alignment:
| Q |
10 |
agagaaactctagtaaccaactctaataatacatcagaatgccttctccactatccatcccctctcttttatctccgtactcacatgagattggtgcaca |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3160313 |
agagaaactctagtaaccaactccaataatacttcagaatgccttctccactacccatcccctctcttttatctccgtactcacatgagattggtgcaca |
3160214 |
T |
|
| Q |
110 |
agtcactaacctatgaagcacgaacacctctaggat |
145 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3160213 |
agtcactaacctatgaagcacggacacctctaggat |
3160178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 5 - 122
Target Start/End: Original strand, 2889409 - 2889526
Alignment:
| Q |
5 |
taactagagaaactctagtaaccaactctaataatacatcagaatgccttctccactatccatcccctctcttttatctccgtactcacatgagattggt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2889409 |
taactagagaaactctagtaaccaactctaacaatacttcagaatgccttctccactacccatcccctctcttttatctccctactcacatgagattggt |
2889508 |
T |
|
| Q |
105 |
gcacaagtcactaaccta |
122 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2889509 |
gcacaagtcactaaccta |
2889526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 2797399 - 2797334
Alignment:
| Q |
10 |
agagaaactctagtaaccaactctaataatacatcagaatgccttctccactatccatcccctctc |
75 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2797399 |
agagaaactctagtaaccaaatctaataatacatcagaatgccttctccactacccatcccctctc |
2797334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 119
Target Start/End: Complemental strand, 4416817 - 4416772
Alignment:
| Q |
74 |
tcttttatctccgtactcacatgagattggtgcacaagtcactaac |
119 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4416817 |
tcttttataaccgtactcatatgagattggtgcacaagtcactaac |
4416772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 40
Target Start/End: Complemental strand, 3145453 - 3145418
Alignment:
| Q |
5 |
taactagagaaactctagtaaccaactctaataata |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3145453 |
taactagagaaactctagtaaccaactctaacaata |
3145418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4796 times since January 2019
Visitors: 4839