View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_16 (Length: 317)
Name: NF0747_low_16
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0747_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 87 - 172
Target Start/End: Original strand, 7952564 - 7952649
Alignment:
| Q |
87 |
aaaacatgatcaattacatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaattgtgtctcacctt |
172 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952564 |
aaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaattgtgtctcacctt |
7952649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 87 - 172
Target Start/End: Original strand, 7936630 - 7936715
Alignment:
| Q |
87 |
aaaacatgatcaattacatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaattgtgtctcacctt |
172 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7936630 |
aaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaactgtgtctcacctt |
7936715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4070 times since January 2019
Visitors: 4827