View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_18 (Length: 300)
Name: NF0747_low_18
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 25120860 - 25121146
Alignment:
Q |
1 |
ttgtttccatttcttggacgatgga----tattgacaactttgccaaccctacaa-gtgttgttgctgcacaaaaaacaagcattaccaacacaaaaacc |
95 |
Q |
|
|
|||||||||||| ||||| |||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
25120860 |
ttgtttccattttttggatgatggacatctattgatgactttgccaaccctacaaagtgttgttgctgcacaaaaaacaagcattcccaacacaaaaacc |
25120959 |
T |
 |
Q |
96 |
aagcatcattcctattttaatctcaaaagttgagattcattctgagtctataccaccctctcttgcaagcacccacaaacatccatccatttctcacaat |
195 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
25120960 |
aagcatcattcctattttgatctcaaaagttgaggttcattctgagtctataccaccctctcttgcaagcacccacaaacatccatccacttctcacaat |
25121059 |
T |
 |
Q |
196 |
aaattttttactttcaaaccttctcatattatgtacctccctttggtgatcttttgtccttgaatcaacaaaaatattcttcgacat |
282 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
25121060 |
aaattttttactttcaaaccttctcatattatgtacctccctttggtgatcttttgtccttgaatcaacaaaaatatttttcgacat |
25121146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University