View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_19 (Length: 288)
Name: NF0747_low_19
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 46 - 240
Target Start/End: Original strand, 39115273 - 39115481
Alignment:
Q |
46 |
agcagagatgagtggttgtggtttaggactgtggttgaacattagcttattaattattcattaggttgcattatatttgtcaccatgggccattcacttc |
145 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39115273 |
agcaaagatgagtggttgtggtttaggactgtggttgaacattagcttattaattattcattaggttgcattatatttgtcaccatgggccattcacttc |
39115372 |
T |
 |
Q |
146 |
acatttgt--------------ataatgtgacagtagatctctatattagaccactataggctagcaatggacttccacttgtgtgcaactttgtctttg |
231 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39115373 |
acatttgtataatttgatttgaataatgtgacagtagatctctatattagaccactataggctagcaatggacttccacttgtgtgcaactttgtctttg |
39115472 |
T |
 |
Q |
232 |
gtgtctgtg |
240 |
Q |
|
|
||||||||| |
|
|
T |
39115473 |
gtgtctgtg |
39115481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 148 - 240
Target Start/End: Complemental strand, 38617217 - 38617125
Alignment:
Q |
148 |
atttgtataatgtgacagtagatctctatattagaccactataggctagcaatggacttccacttgtgtgcaactttgtctttggtgtctgtg |
240 |
Q |
|
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
T |
38617217 |
atttgaataatgtgaaagtagatctctatattagaccactataggctagcaatggacttccacttgagtgcaactttgtctttcgtgtctgtg |
38617125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University