View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_21 (Length: 272)
Name: NF0747_low_21
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0747_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 30 - 272
Target Start/End: Original strand, 14192097 - 14192340
Alignment:
| Q |
30 |
ttctcttctaattctaaattctaactcaccacatatttt-ttctttgtttgaaagatggcagtcatccctaacaggcaagcagcgttggagtctagactt |
128 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
14192097 |
ttctgttctaattctaaattctaactcaccacatatttttttctttgtttgaaagatggcaattatcccttacatgcaagcagtgttggagtctagactt |
14192196 |
T |
|
| Q |
129 |
tacgaagaagttcatccatgcagcatttgcagggttccnnnnnnncttcgagacctaaaaaaggacgcttacacgccaaagtctatctttatagggttct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14192197 |
tacgaagaagttcatccatgcagcatttgcagggttccaaacaaacttcgagacctaaaagaggacgcttacacgccaaagtctatctttataggactct |
14192296 |
T |
|
| Q |
229 |
tacccaggggagaaacgagctaccaccaagtccaattgatggta |
272 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14192297 |
tacccaggggagaaacgaactaccgccaagtccaattgatggta |
14192340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4684 times since January 2019
Visitors: 4838