View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_26 (Length: 258)
Name: NF0747_low_26
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0747_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 36 - 229
Target Start/End: Original strand, 36650941 - 36651136
Alignment:
Q |
36 |
tattttattcagcataaactatattttatgactatccgaggaaaatattgtattctc--tctactttcattgtcatttattagaaatgtgagctatggta |
133 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36650941 |
tattttattcagcataaactatattttatgactatccgaggaaaatattgtattctctctctactttcattgtcatttattagaaatgtgagctatggtc |
36651040 |
T |
 |
Q |
134 |
cagtttttcgtctacacagtaatctcagccaaaagtgctaatatgtattttcaaatatcacaagcagggatggagtcagaaattaagcttaggggg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36651041 |
cagtttttcgtctacacagtaatctcagccaaaagtgctaatatgtattttcaaatatcacaagcagggatggagtcagaaattaagcttaggggg |
36651136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3029 times since January 2019
Visitors: 4805