View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0747_low_29 (Length: 251)
Name: NF0747_low_29
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0747_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 25 - 246
Target Start/End: Original strand, 14192413 - 14192634
Alignment:
| Q |
25 |
acaatgttaagggcatgtaacgtagatattcccatatttgaaatagacacccgcgcaagctatgatgctagcatcttaggttcagaattaactgcagatg |
124 |
Q |
| |
|
|||| |||||| ||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
14192413 |
acaaggttaagtgcatgtagcgaagatattcccatatttgaaatagacatccgcgcaagctatgatggtagcatcttaggttcagaattaactacagatg |
14192512 |
T |
|
| Q |
125 |
ttatcgggagaacaatgatattggatggttgttttctgttacagtttctcagtaaacttaatcagccagcaatagatgccgaagacccaatatttgaaac |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| | || ||| |||||||| || ||||||||||||||||||| |
|
|
| T |
14192513 |
ttatcgggagaaaaatgatattggatggttgttttctgttacagcttctcagtagacttgaacacccaacaatagatccccaagacccaatatttgaaac |
14192612 |
T |
|
| Q |
225 |
cagggaaaagatctgtgctgct |
246 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
14192613 |
cagggaaaagatgtgtgctgct |
14192634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3508 times since January 2019
Visitors: 4814