View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0747_low_39 (Length: 204)

Name: NF0747_low_39
Description: NF0747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0747_low_39
NF0747_low_39
[»] chr6 (1 HSPs)
chr6 (1-124)||(7927899-7928022)


Alignment Details
Target: chr6 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 7928022 - 7927899
Alignment:
1 acactgattcgtcgacaggtatcaattatgtcacatgcaactacgattctatcctcggtgaagctctgactgcgattctcctcaccaaaatcactatgca 100  Q
    ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
7928022 acactgattcgtcgacaggtatcaattctgtcacatgcgactacgattctatcctcggtgaagctctcactgcgattctcctcaccaaaatcactatgca 7927923  T
101 tctctcactaacaacttttcatct 124  Q
    ||||||||||||||||||||||||    
7927922 tctctcactaacaacttttcatct 7927899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3152 times since January 2019
Visitors: 4805